Back to the main page

Mailing List Logs for ShadowRN

Message no. 1
From: zebulingod@*****.com (Zebulin Magby)
Subject: Update
Date: Thu, 17 Oct 2002 17:55:21 -0700
I'm a mite busy right now and cannot write something suitable for the
dealership blowout. Would it be possible for Newzjunkie or another of the
newshounds to release a story regarding the dealership being hit by
Terra-First terrorists or some such? (Yes, it's obviously a cover, but the
police won't be able to determine that for months.)

I'd be rather grateful. Figure most of the damage would be good ol fashioned
molotov cocktails. You know, anything a eco-terrorist group could get their
grubby little mits on. And some sprayed slogans such as "Terra First!" or
"Die, you blight of the land!"

Zebulin
Message no. 2
From: flash119is@*****.com (Opher Lubzens)
Subject: Update
Date: Fri, 18 Oct 2002 14:21:28 -0700 (PDT)
Paul- what is the level of security in the club?And
how many goons are Flash and The Crete looking at?

====Opher Lubzens
"The pessimists are usually correct but the optimists have more fun"- Robert A.
Heinlin

__________________________________________________
Do you Yahoo!?
Faith Hill - Exclusive Performances, Videos & More
http://faith.yahoo.com
Message no. 3
From: flash119is@*****.com (Opher Lubzens)
Subject: Update
Date: Sat, 26 Oct 2002 09:32:18 -0700 (PDT)
Would it disturb anyone if I introduced a weakened,
toxin, version of Spasm(in the book I take it from,
"The Man Who Never Missed", it was a gengineered virus
that causes al the volantury muscles to contract- and
stay contracted -for half a year) that will hold for
between 1-2 months(depending on the person)

====Opher Lubzens
"The pessimists are usually correct but the optimists have more fun"- Robert A.
Heinlin

__________________________________________________
Do you Yahoo!?
Y! Web Hosting - Let the expert host your web site
http://webhosting.yahoo.com/
Message no. 4
From: loneeagle@********.co.uk (Lone Eagle)
Subject: Update
Date: Sat, 26 Oct 2002 21:26:58 +0100
At 09:32 AM 26/10/2002 -0700, Opher Lubzens wrote:
>Would it disturb anyone if I introduced a weakened,
>toxin, version of Spasm(in the book I take it from,
>"The Man Who Never Missed", it was a gengineered virus
>that causes al the volantury muscles to contract- and
>stay contracted -for half a year) that will hold for
>between 1-2 months(depending on the person)

It depends on who you introduce it to ;-)

Seriously though, I think the time window your looking is a little extreme,
anything that could be used on the PCs that has that sort of long term
effect (and can be used on them without them screwing up) is likely to have
players up in arms. If you're planning to use it as a plot device I'd
suggest that you add a requirement. I'd suggest that if you say that the
toxin has to be introduced over an extended period in order to have full
effect that might work.
Incidentally I can't be sure but I think that if all of the voluntary
muscle groups spasmed simultaneously and without the controls the body
normally puts on them you'd probably find that a lot of tearing and
ligament damage, possibly even spinal damage.


--
Lone Eagle
"Hold up lads, I got an idea."

www.wyrmtalk.co.uk - Please be patient, this site is under construction

-----BEGIN GEEK CODE BLOCK-----
Version: 3.12
GE d++(---) s++: a->? C++(+) US++ P! L E? W++ N o? K? w+ O! M- V? PS+ PE-()
Y PGP? t+@ 5++ X- R+>+++$>* tv b+++ DI++++ D+ G++ e+ h r* y+>+++++
-----END GEEK CODE BLOCK-----

-----BEGIN SR GEEK CODE BLOCK-----
Version: 0.22
SR1+ SR2+ SR3++ h++ b++(+++) B? UB+ !IE(+) RN++>++++ STK+ LST+ NERPS+>+++
W- dk+(+++) sa-- ma- jat++++ m+(-) gm+(++) M-- P(+++)
-----END SR GEEK CODE BLOCK-----

GCC0.2: y75>?.uk[NN] G87 S@:@@[SR] B+++ f+ RM(RR) rm++ rr++ l++(--) m- w
s+(+++) GM+++(-) A GS+(-) h++ LA+++ CG--- F c+

"Let all who go to don armour tomorrow remember to go _before_ they don
armour tomorrow."
The Black Adder
(The Foretelling)
Message no. 5
From: chicken@********.net.nz (Jaimie)
Subject: Update
Date: Sun, 27 Oct 2002 10:23:18 +1300
Lone Eagle wrote:
>
> At 09:32 AM 26/10/2002 -0700, Opher Lubzens wrote:
> >Would it disturb anyone if I introduced a weakened,
> >toxin, version of Spasm(in the book I take it from,
> >"The Man Who Never Missed", it was a gengineered virus
> >that causes al the volantury muscles to contract- and
> >stay contracted -for half a year) that will hold for
> >between 1-2 months(depending on the person)

I'm not convinced it should last that long... if the body can metabolise
and get rid of it ever, then it should go faster than that. Also you
should get a gradual lessening of the effect spread over the last half
or so of the time.

> It depends on who you introduce it to ;-)

LOL

> Incidentally I can't be sure but I think that if all of the voluntary
> muscle groups spasmed simultaneously and without the controls the body
> normally puts on them you'd probably find that a lot of tearing and
> ligament damage, possibly even spinal damage.

Yes, especially given the time frame. And it would hurt like hell.
Message no. 6
From: jjmach@**********.com (Jeffrey Mach)
Subject: Update
Date: Sun, 27 Oct 2002 13:02:33 -0800
> -----Original Message-----
> From: plotd-bounces@*****.dumpshock.com
> [mailto:plotd-bounces@*****.dumpshock.com] On Behalf Of Jaimie
> Sent: Saturday, October 26, 2002 2:23 PM
> To: ShadowTk Plot and Administrative Discussion
> Subject: Re: Update
>
>
> Lone Eagle wrote:
> >
> > At 09:32 AM 26/10/2002 -0700, Opher Lubzens wrote:
> > >Would it disturb anyone if I introduced a weakened,
> > >toxin, version of Spasm(in the book I take it from,
> > >"The Man Who Never Missed", it was a gengineered virus
> > >that causes al the volantury muscles to contract- and
> > >stay contracted -for half a year) that will hold for
> > >between 1-2 months(depending on the person)

Wouldn't it last until the virus could be extracted from your system?
It's not "easy" for a virus to be coded for some sort of time limit.
(They don't exactly make watches in that size.) The alternative would
be that in X amount of time you sneak in an administer a counter-agent.

> I'm not convinced it should last that long... if the body can
metabolise
> and get rid of it ever, then it should go faster than that. Also you
> should get a gradual lessening of the effect spread over the last half
> or so of the time.

Also depends on how the virus works. If it works on nerves, that is
really hard, also when dealing with the spinal cord and brain, there are
additional blood barriers to prevent infection. Affecting the rough
muscle would work easier. One route: the virus is designed to only
enter "rough" muscle (not including the heart) and then tag it so other
viruses will pass on by, then, instead of causing the cell to replicate,
it causes the cellular automata to contract the muscle cell, and keep
contracting as long as it has energy to do so. This isn't going to go
away until the body can rid itself of the infection, but that could
potentially mean destroying significant amounts of muscle tissue, or a
counter-agent which causes the virus to self-destruct/cease to function
is introduced.

> > Incidentally I can't be sure but I think that if all of the
voluntary
> > muscle groups spasmed simultaneously and without the controls the
body
> > normally puts on them you'd probably find that a lot of tearing and
> > ligament damage, possibly even spinal damage.
>
> Yes, especially given the time frame. And it would hurt like hell.

At least until they could pump the person full of enough muscle
relaxants to turn them into a big blob of Jell-O (tm). Not a very
effective state, either, but at least you aren't in excruciating pain.
Would have to be on a ventilator, probably.

--Catch
you later

Jeff
Message no. 7
From: chicken@********.net.nz (Jaimie)
Subject: Update
Date: Mon, 28 Oct 2002 10:54:21 +1300
Jeffrey Mach wrote:
>
> > -----Original Message-----
> > From: plotd-bounces@*****.dumpshock.com
> > [mailto:plotd-bounces@*****.dumpshock.com] On Behalf Of Jaimie
> > Sent: Saturday, October 26, 2002 2:23 PM
> > To: ShadowTk Plot and Administrative Discussion
> > Subject: Re: Update
> >
> >
> > Lone Eagle wrote:
> > >
> > > At 09:32 AM 26/10/2002 -0700, Opher Lubzens wrote:
> > > >Would it disturb anyone if I introduced a weakened,
> > > >toxin, version of Spasm(in the book I take it from,
> > > >"The Man Who Never Missed", it was a gengineered virus
> > > >that causes al the volantury muscles to contract- and
> > > >stay contracted -for half a year) that will hold for
> > > >between 1-2 months(depending on the person)

I think the general opinion is yeah, sure, why not... but medical
treatments are going to make your victim's life slightly easier.
Message no. 8
From: PlotD@********.demon.co.uk (Paul J. Adam)
Subject: Update
Date: Tue, 29 Oct 2002 18:10:35 +0000
In message <20021026163218.73442.qmail@********.mail.yahoo.com>, Opher
Lubzens <flash119is@*****.com> writes
>Would it disturb anyone if I introduced a weakened,
>toxin, version of Spasm(in the book I take it from,
>"The Man Who Never Missed", it was a gengineered virus
>that causes al the volantury muscles to contract- and
>stay contracted -for half a year) that will hold for
>between 1-2 months(depending on the person)

Should be rare, expensive and unusual, but as long as it's uncommon I
don't see it as a huge problem...

--
Paul J. Adam
Message no. 9
From: "Robert A. Hayden" <hayden@*******.MANKATO.MSUS.EDU>
Subject: Update
Date: Sun, 5 Dec 1993 16:01:13 -0600
As I said, everything I had was gone.

I contacted the sysadmin, and she said the most recent backup was about
13 days old. This is not good, but it could be worse. I did manage to
save a couple of files, most notably the FAQs for all of the lists, but
once the files are restored, I'll have about 48 hours or so of rebuilding
to do (lots of scripts lost).

Look at that, the prick even stole my .signature.

We think we know who it is, we might even be able to get him.

The bad part is, as I feared, I did lose all of the reseach for my thesis.

*sigh*

I am going to get myself a really stiff drink now and try to wash the
adrenelin out of my system. This is most UN-FUN.
Message no. 10
From: Ahern T Stephan <maxim@*******.MANKATO.MSUS.EDU>
Subject: Update
Date: Sat, 5 Mar 1994 15:02:19 -0600
I have now subscribed to tk and plot-d via my Unix accout. I am no longer
using my vax1 accout for any of the lists. Just so you know that.
Also, is there an easy way of deleting your signature without pressing
the del key forever?



--
Ahern T. Stephan
maxim@*******.mankato.msus.edu


1 GCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGC
61 GGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCG
121 TGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGC
241 CCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAA
301 AGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAG
361 ATCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACT
421 CCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCTGGGCT
481 GGCGTTCGCGACGCGAGGCTGGATGGCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGG
541 CCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAA

The above is a semi complete strand of dinosaur DNA. I have
about 13 more lines to complete. This pattern can be found
on page 102 of "Jurasic Park"
Message no. 11
From: Gian-Paolo Musumeci <musumeci@***.LIS.UIUC.EDU>
Subject: Re: Update
Date: Sat, 5 Mar 1994 15:12:40 -0600
Please kill your .signature. It is considered a breach of netiquette to have
a .signature longer than about 5 lines.

Further Reading

If you enjoyed reading about Update, you may also be interested in:

Disclaimer

These messages were posted a long time ago on a mailing list far, far away. The copyright to their contents probably lies with the original authors of the individual messages, but since they were published in an electronic forum that anyone could subscribe to, and the logs were available to subscribers and most likely non-subscribers as well, it's felt that re-publishing them here is a kind of public service.